Sequence::Fasta Class Reference
[Classes for sequence I/O]

FASTA sequence stream. More...

#include <Sequence/Fasta.hpp>

Inheritance diagram for Sequence::Fasta:

Public Types
typedef std::string::iterator	iterator
typedef std::string::const_iterator	const_iterator
typedef std::string::reference	reference
typedef std::string::const_reference	const_reference
typedef std::string::size_type	size_type
Public Member Functions
	Fasta ()
	Fasta (const std::string &name, const std::string &seq)
	Fasta (const char name, const char seq)
	Fasta (const Seq &s)
	~Fasta ()
std::istream &	read (std::istream &s) throw (Sequence::badFormat,std::exception)
std::ostream &	print (std::ostream &s) const
std::string	GetName (void) const
std::string	GetSeq (void) const
std::string	substr (unsigned beg, unsigned len) const
std::string	substr (unsigned beg) const
iterator	begin ()
const_iterator	begin () const
iterator	end ()
const_iterator	end () const
void	Revcom (void)
void	Subseq (unsigned, unsigned)
void	Complement (void)
size_type	length (void) const
size_type	UngappedLength (void) const
bool	IsGapped (void) const
reference	operator[] (const size_type &i)
const_reference	operator[] (const size_type &i) const
bool	operator== (const Seq &rhs) const
bool	operator!= (const Seq &rhs) const
	operator std::string () const
const char *	c_str (void) const

Detailed Description

FASTA sequence stream.

Publicly derived from Sequence::Seq, this class defines how to read and print sequences in FASTA format, which looks like:
>sequence name 1
ATGATGATCAGATAGACATAGCAGATACATGT
>sequence name 2
ATGTTGGTTTTTTTTTAGAGATGTTTATAGGT
ETC...

Examples:: baseComp.cc, codons.cc, and valid_dna.cc.

Definition at line 49 of file Fasta.hpp.

Member Typedef Documentation

typedef std::string::const_iterator Sequence::Seq::const_iterator [inherited]

Const iterator to sequence elements. Iterators access the data, not the seuquence name. Value type de-references to char

Definition at line 72 of file Seq.hpp.

typedef std::string::iterator Sequence::Seq::iterator [inherited]

Iterator to sequence elements. Iterators access the data, not the seuquence name. Value type de-references to char

Definition at line 66 of file Seq.hpp.

Constructor & Destructor Documentation

Sequence::Fasta::Fasta ( ) [inline]

Generic constructor

Definition at line 53 of file Fasta.hpp.

Sequence::Fasta::Fasta	(	const std::string &	name,
		const std::string &	seq
	)

constructor for const std::string

Definition at line 31 of file Fasta.cc.

Sequence::Fasta::Fasta	(	const char *	name,
		const char *	seq
	)

constructor for const char *

Definition at line 37 of file Fasta.cc.

Sequence::Fasta::Fasta ( const Seq & seq )

copy constructor

Definition at line 43 of file Fasta.cc.

Sequence::Fasta::~Fasta ( ) [inline]

placeholder for vtable

Definition at line 57 of file Fasta.hpp.

Member Function Documentation

Seq::const_iterator Sequence::Seq::begin ( ) const [inherited]

Returns:: a const iterator to the beginning of the sequence

Definition at line 209 of file Seq.cc.

Seq::iterator Sequence::Seq::begin ( ) [inherited]

Returns:: an iterator to the beginning of the sequence

Examples:: valid_dna.cc.

Definition at line 193 of file Seq.cc.

const char * Sequence::Seq::c_str ( void ) const [inherited]

Returns:: the the C-style string representing the sequence as a cont char *

Definition at line 225 of file Seq.cc.

void Sequence::Seq::Complement ( void ) [inherited]

Complement the Sequence

Note:: This modifies the data in the object by changing the std::string--if you want to keep the original sequence, you need to make a copy of the object first.

Definition at line 169 of file Seq.cc.

Seq::const_iterator Sequence::Seq::end ( ) const [inherited]

Returns:: a const iterator to the end of the sequence

Definition at line 217 of file Seq.cc.

Seq::iterator Sequence::Seq::end ( ) [inherited]

Returns:: an iterator to the end of the sequence

Examples:: valid_dna.cc.

Definition at line 201 of file Seq.cc.

std::string Sequence::Seq::GetName ( void ) const [inherited]

Return the sequence name

Examples:: baseComp.cc.

Definition at line 45 of file Seq.cc.

std::string Sequence::Seq::GetSeq ( void ) const [inherited]

Return the sequence itself

Definition at line 53 of file Seq.cc.

bool Sequence::Seq::IsGapped ( void ) const [inherited]

Returns 1 if the sequence contaings the gap character '-', 0 otherwise

Definition at line 145 of file Seq.cc.

Seq::size_type Sequence::Seq::length ( void ) const [inherited]

Return the total length of the sequence

Examples:: codons.cc.

Definition at line 77 of file Seq.cc.

Sequence::Seq::operator std::string ( ) const [inherited]

allows (implict) cast to std::string

Definition at line 127 of file Seq.cc.

bool Sequence::Seq::operator!= ( const Seq & rhs ) const [inherited]

Returns:: false if the sequences contain the same data, true otherwise.

Note:: only the sequences (i.e. this->second and rhs.second) are compared

Definition at line 117 of file Seq.cc.

bool Sequence::Seq::operator== ( const Seq & rhs ) const [inherited]

Returns:: true if the sequences contain the same data, false otherwise.

Note:: only the sequences (i.e. this->second and rhs.second) are compared

Definition at line 107 of file Seq.cc.

Seq::const_reference Sequence::Seq::operator[] ( const size_type & i ) const [inherited]

Return the i-th element of the sequence.

Note:: range-checking is done by assert()

Definition at line 97 of file Seq.cc.

Seq::reference Sequence::Seq::operator[] ( const size_type & i ) [inherited]

Return the i-th element of the sequence.

Note:: range-checking is done by assert()

Definition at line 86 of file Seq.cc.

std::ostream & Sequence::Fasta::print ( std::ostream & s ) const [virtual]

Parameters:

stream

a std::ostream write the sequence in FASTA format to stream

Implements Sequence::Seq.

Definition at line 99 of file Fasta.cc.

std::istream & Sequence::Fasta::read ( std::istream & s ) throw (Sequence::badFormat,std::exception) [virtual]

Exceptions:

	Sequence::SeqException	if memory can't be allocated. (This is because the data are temporarily read into char *, because that was found to be faster).
	Sequence::badFormat	if the input stream is not in FASTA format

Implements Sequence::Seq.

Definition at line 47 of file Fasta.cc.

void Sequence::Seq::Revcom ( void ) [inherited]

Reverse and complement the sequence.

Note:: This function modifies the data in the object by changing the std::string--if you want to keep the original sequence, you need to make a copy of the object first.

Returns:: *this

Definition at line 180 of file Seq.cc.

void Sequence::Seq::Subseq	(	unsigned	beg,
		unsigned	length
	)			`[inherited]`

Parameters:

	beg	the index along the sequence at which the substring begins
	length	the length of the subseq Acts via std::string.substr(). Note that this modifies the data in the object by changing thestd::string--if you want to keep the original sequence, you need to make a copy of the object first.

Note:: range-checking done by assert()

Definition at line 154 of file Seq.cc.

std::string Sequence::Seq::substr ( unsigned beg ) const [inherited]

Mimics the standardstd::string member function of the same name.

Definition at line 69 of file Seq.cc.

std::string Sequence::Seq::substr	(	unsigned	beg,
		unsigned	len
	)			const `[inherited]`

Mimics the std::string member function of the same name.

Definition at line 61 of file Seq.cc.

Seq::size_type Sequence::Seq::UngappedLength ( void ) const [inherited]

Return length of sequence, excluding the gap character '-'

Definition at line 136 of file Seq.cc.

The documentation for this class was generated from the following files:

Sequence::Fasta Class Reference [Classes for sequence I/O]

Public Types

Public Member Functions

Detailed Description

Member Typedef Documentation

Constructor & Destructor Documentation

Member Function Documentation

Sequence::Fasta Class Reference
[Classes for sequence I/O]